B30m7l03assign25
.doc
School
Nelson Mandela High School**We aren't endorsed by this school
Course
BIOLOGY 30
Subject
Biology
Date
Dec 22, 2024
Pages
3
Uploaded by DrSardine4538
Biology 30: Module 7: Lesson 3 1Assignment MODULE 7: LESSON 3 ASSIGNMENTThis Module 7: Lesson 3 Assignment is worth 24 marks. The value of each assignment and each question is stated in the left margin.(24 marks)Lesson 3 Assignment: Protein SynthesisPart 1: RNA and Protein Synthesis Simulation(2 marks)1.How did the strand of mRNA you made compare to the left side (the anti-sense strand) of the unzipped DNA strand? What was the same? What was different?Answer:(1 mark)2.The UAC anticodon is the initiator. What amino acid is anticodon always attached to? Answer:(2 marks) 3.Describe what happens when you add the third tRNA anticodon to the mRNA strand.Answer:4.The original sense strand of DNA had the following nucleotide sequence:TACCCCGCGAAATATTTCCTAATT(2 marks)a.What is the nucleotide sequence of the mRNA transcribed from this DNA template?Answer:(2 marks)b.What is the amino acid sequence of the polypeptide that is produced from the mRNA strand?Answer:
Biology 30: Module 7: Lesson 3 2Assignment Part 2: Transcription in Reverse (15 marks)1.In this activity you will work backward from an amino acid sequence toward the original DNA sense strand. Follow the procedure for “Thought Lab 18.2: Transcription in Reverse”.Complete “Procedure” questions 1 and 2. Table 18.3 is at the top of the course content page. Place your answers in the answer box provided; otherwise, submit them to your teacher with your completed assignment when instructed to do so later in this lesson. (5 marks)Complete “Analysis” questions 1 and 2. Submit your work in the answer box.(5 marks each = 10 marks)
Biology 30: Module 7: Lesson 3 3Assignment Answer:Once you have completed all of the questions, submit your work to your teacher.